ID c1348 standard; DNA; FUN; 666 BP. AC c1348; FH Key Location/Qualifiers FH FT misc_feature complement(1..6535) FT /note="region of high similar to c212 S. pombe chromosome FT 1(telomeric)" FT LTR complement(997..1215) FT /note="218 (-1) 37 254 Tf2-type LTR" FT LTR complement(1296..1591) FT /note="464 (-1) 56 349 Tf2-type LTR" FT LTR complement(2756..3054) FT /note="176 (-1) 2 299 Tf2-type LTR" FT LTR 4835..5191 FT /note="524 (+1) 1 354 Tf1-type LTR" FT CDS join(5451..5940,5999..6318) FT /colour=12 FT /gene="SPAC1348.01" FT /label=SPAC1348.01 FT /note="SPAC1348.01, len:269" FT /product="hypothetical protein; duplicated telomeric FT region; contains 4 predicted transmembrane helices; FT possibly S. pombe specific; has late log phase cDNA; FT highly similar to S. pombe SPAC212.01c; highly similar to FT S. pombe SPAC1348.07" FT /fasta_file="fasta/c1348.tab.seq.00473.out" FT misc_feature 5941..5946 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 5982..5998 FT /colour=6 FT /note="ctaataatttaaaatag, splice branch and acceptor" FT CDS 7980..9014 FT /colour=12 FT /gene="SPAC1348.02" FT /label=SPAC1348.02 FT /note="SPAC1348.02, len:344," FT /product="hypothetical protein; contains 5 predicted FT transmembrane helices; low similarity to membrane FT transporter; highly similar to SPBPB2B2.19C SPAC750.05C FT SPAC977.01; possibly S. pombe specific; low similar to S. FT cerevisiae YHL017W is possibly spurious" FT /fasta_file="fasta/c1348.tab.seq.00474.out" FT misc_feature 8062..12662 FT /note="region of high similarity to SPAC977 S. pombe FT chromosome 1 (telomeric)" FT CDS 10569..11009 FT /colour=12 FT /gene="SPAC1348.03" FT /label=SPAC1348.03 FT /note="SPAC1348.03, len:145" FT /product="hypothetical protein; duplicated telomeric FT region; possibly S. pombe specific; highly similar to S. FT pombe SPAC750.04C SPAC977.02" FT /fasta_file="fasta/c1348.tab.seq.00475.out" FT CDS 12176..12613 FT /colour=7 FT /gene="SPAC1348.04" FT /label=SPAC1348.04 FT /note="SPAC1348.04, len:161" FT /product="putative sterol methyltransferase; duplicated in FT S. pombe see SPAC750.03C and SPAC977.03; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c1348.tab.seq.00049.out" FT CDS 13572..15029 FT /colour=7 FT /gene="SPAC1348.05" FT /label=SPAC1348.05 FT /note="SPAC1348.05, len:485, FT SIMILARITY:Schizosaccharomyces pombe, Q9USN4, putative FT membrane transporter, (462 aa), fasta scores: opt: 878, FT E():0, (32.6% identity in 429 aa)" FT /product="putative membrane transporter; contains PfamB_83" FT /fasta_file="fasta/c1348.tab.seq.00477.out" FT misc_feature 14527..29514 FT /note="region of similar to SPAC977 S. pombe chromosome FT 1(telomeric)" FT CDS complement(15981..16592) FT /colour=10 FT /gene="SPAC1348.06c" FT /label=SPAC1348.06c FT /note="SPAC1348.06c, len:203, SIMILARITY:Saccharomyces FT cerevisiae, Q08910, chromosome xv reading frame orf FT yor387c., (206 aa), fasta scores: opt: 786, E():0, (55.5% FT identity in 200 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOR387C" FT /fasta_file="fasta/c1348.tab.seq.00478.out" FT CDS join(19641..20058,20109..20383) FT /colour=12 FT /gene="SPAC1348.07" FT /label=SPAC1348.07 FT /note="SPAC1348.07, len:230" FT /product="hypothetical protein; duplicated at S. pombe FT telomeres; possibly S. pombe specific; contains 3 FT predicted transmembrane helices; highly similar to S. FT pombe SPAC212.01c; highly similar to S. pombe SPAC1348.01" FT /fasta_file="fasta/c1348.tab.seq.00479.out" FT misc_feature 20059..20064 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 20092..20108 FT /colour=6 FT /note="ctaataatttaaaatag, splice branch and acceptor" FT CDS complement(22279..23529) FT /colour=12 FT /gene="SPAC1348.08c" FT /label=SPAC1348.08c FT /note="SPAC1348.08c, len:416, FT SIMILARITY:Schizosaccharomyces pombe, YAH2_SCHPO, FT hypothetical 62.9 kD protein c8a4.02c in chromosome i., FT (609 aa), fasta scores: opt: 1354, E():0, (56.3% identity FT in 378 aa)" FT /product="hypothetical threonine-rich protein; similar to FT SPAC1F8.06, and SPAC8A4.02C; possibly S. pombe specific; FT predicted N-terminal signal sequence" FT /fasta_file="fasta/c1348.tab.seq.00480.out" FT misc_feature 24880..25365 FT /note="Match to PF00106 adh_short, short chain FT dehydrogenase Score 87.89" FT CDS 24916..25626 FT /colour=7 FT /gene="SPAC1348.09" FT /label=SPAC1348.09 FT /note="SPAC1348.09, len:236, SIMILARITY:Burkholderia FT cepacia, Q51641, insect-type dehydrogenase., (249 aa), FT fasta scores: opt: 371, E():7.3e-17, (32.1% identity in FT 221 aa)" FT /product="putative short chain dehydrogenase" FT /fasta_file="fasta/c1348.tab.seq.00481.out" FT CDS complement(join(26287..26355,26420..28372)) FT /colour=7 FT /gene="SPAC1348.10c" FT /label=SPAC1348.10c FT /note="SPAC1348.10c, len:673, FT SIMILARITY:Schizosaccharomyces pombe, O13857, putative FT lysophospholipase , (624 aa), fasta scores: opt: 3142, FT E():0, (74.7% identity in 598 aa)" FT /product="putative lysophospholipase" FT /fasta_file="fasta/c1348.tab.seq.00482.out" FT misc_feature complement(26356..26371) FT /colour=6 FT /note="ctaacttttgttctag, splice branch and acceptor" FT intron complement(26356..26419) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(26414..26419) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(26423..28234) FT /note="Match to PF01735 PLA2_B, Lysophospholipase FT catalytic domain Score 1033.69" FT CDS 33231..34820 FT /colour=4 FT /gene="SPAC1348.11" FT /label=SPAC1348.11 FT /note="SPAC1348.11, len:514, FT SIMILARITY:Schizosaccharomyces pombe, YAO5_SCHPO, FT hypothetical 61.1 kD protein c11d3.05 in chromosome i., FT (546 aa), fasta scores: opt: 2344, E():0, (68.5% identity FT in 546 aa)" FT /product="predicted transmembrane transporter pseudogene" FT /pseudo FT /fasta_file="fasta/c1348.tab.seq.00483.out" FT misc_feature join(33231..33564,33606..34291,34295..34768, FT 34770..34820) FT /fasta_file="fasta/c1348.tab.seq.00046.out" FT /note="SPAC1348.11 pseudo gene" FT CDS 35223..36658 FT /colour=4 FT /gene="SPAC1348.12" FT /label=SPAC1348.12 FT /note="SPAC1348.12, len:475, SIMILARITY:Saccharomyces FT cerevisiae, Q08904, chromosome xv reading frame orf FT yor380w., (546 aa), fasta scores: opt: 663, E():0, (31.9% FT identity in 480 aa)" FT /product="zinc finger protein; pseudo" FT /pseudo FT /fasta_file="fasta/c1348.tab.seq.00484.out" FT misc_feature join(35223..35663,35667..35924,35924..36172,36176..36586, FT 36590..36658) FT /fasta_file="fasta/c1348.tab.seq.00047.out" FT /note="SPAC1348.12 pseudogene" FT misc_feature 35244..35345 FT /note="Match to PF00172 Zn_clus, fungal Zn(2)-Cys(6) FT binuclear cluster domain Score 46.12" FT CDS 36901..37263 FT /colour=4 FT /gene="SPAC1348.13" FT /label=SPAC1348.13 FT /note="SPAC1348.13, len:119, SIMILARITY:Agrocybe aegerita., FT O47565, coi i2 protein., (265 aa), fasta scores: opt: FT 381, E():2.4e-20, (49.6% identity in 121 aa)" FT /product="similar to fragment of cox1 intron protein; FT pseudogene" FT /pseudo FT /fasta_file="fasta/c1348.tab.seq.00485.out" FT misc_feature join(36901..37185,37189..37263) FT /fasta_file="fasta/c1348.tab.seq.00048.out" FT /note="SPAC1348.13 pseudogene" FT CDS complement(38587..40143) FT /colour=7 FT /gene="SPAP8B6.01c" FT /gene="SPAC1348.14" FT /product="putative glucose transporter; ght7?" FT /fasta_file="fasta/pB8B6.tab.seq.00020.out" FT misc_feature 38440..39186 FT /note="nominal overlap with SPAC1348 S. pombe chromosome 1" FT CDS complement(44810..46831) FT /product="putative SSS urea transporter; similar to S. FT pombe SPAC869.03C (paralog); similar to S. pombe FT SPBC23G7.13C (paralog); similar to S. cerevisiae DUR3" FT /fasta_file="fasta/pB8B6.tab.seq.00019.out" FT /colour=7 FT /gene="SPAP8B6.02c" FT CDS 47428..49071 FT /colour=7 FT /fasta_file="fasta/pB8B6.tab.seq.00018.out" FT /product="putative acetamidase; similar to S. cerevisiae FT AMD2" FT /EC_number="3.5.1.4" FT /gene="SPAP8B6.03" FT CDS complement(join(49143..50910,50953..51062,51113..51181)) FT /product="zinc finger protein; fungal binuclear cluster FT domain; suppresses a defect in the onset of anaphase of FT fission yeast slp1 mutant (PMID: 11058086)" FT /fasta_file="fasta/pB8B6.tab.seq.00033.out" FT /colour=2 FT /gene="grt1" FT /gene="SPAP8B6.04c" FT misc_feature complement(50911..50923) FT /note="ttaatataaatag, splice branch and acceptor" FT /colour=6 FT misc_feature complement(50947..50952) FT /note="gtatac, splice donor sequence" FT /colour=6 FT misc_feature complement(51063..51074) FT /note="ttaacaattaag, splice branch and acceptor" FT /colour=6 FT misc_feature complement(51107..51112) FT /note="gtgagt, splice donor sequence" FT /colour=6 FT intron complement(53418..53455) FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=16.78" FT /score=1.678 FT misc_feature complement(54135..56795) FT /note="duplicated region in SPAC977 S. pombe chromosome 1" FT CDS complement(54497..55567) FT /product="putative L-asparaginase; similar to S. pombe FT SPAC977.12 (paralog); similar to S. pombe SPAC186.03 FT (paralog); similar to S. cerevisiae ASP3" FT /colour=7 FT /fasta_file="fasta/pB8B6.tab.seq.00016.out" FT /EC_number="3.5.1.1" FT /gene="SPAP8B6.05c" FT intron complement(55695..55810) FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=7.60" FT /score=0.76 FT CDS complement(55850..56785) FT /colour=10 FT /fasta_file="fasta/pB8B6.tab.seq.00015.out" FT /product="hypothetical protein; duplicated in S. pombe; FT identical to S. pombe SPAC8F11.09C; similar to S. FT cerevisiae YOR390W; predicted transmembrane" FT /gene="SPAP8B6.06c" FT misc_feature complement(56925..57077) FT /note="duplicated region in SPAC977 S. pombe chromosome 1" FT LTR complement(57151..57483) FT /note="261 (+1) 34 358 Tf1-type LTR" FT LTR complement(57604..57821) FT /note="179 (+1) 1 215 Tf1-type LTR" FT CDS complement(1732691..1733677) FT /colour=2 FT /gene="swi6" FT /gene="SPAC824.10c" FT /gene="SPAC664.01c" FT /label=swi6 FT /note="SPAC824.10c, len:328" FT /product="determines mating-type donor choice; required FT for transcriptional silencing at the mating type loci; FT required for chromosome segregation; chromodomain protein; FT binds centromeric flanking sequence; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c824.tab.seq.00384.out" FT /fasta_file="fasta/c664.tab.seq.00016.out" FT /note="SPAC664.01c, len:328" FT CDS complement(join(281402..282013,282068..282428, FT 282621..282634)) FT /colour=7 FT /gene="SPAC806.09c" FT /label=SPAC806.09c FT /note="putative incorrect N-terminal" FT /note="SPAC806.09c, len:316, SIMILARITY:Saccharomyces FT italicus, AAB87766, v-snare bypass mutant., (347 aa), FT fasta scores: opt: 590, E():0, (46.3% identity in 307 aa)" FT /product="SUR4 family protein; putative fatty acid FT elongation protein" FT /fasta_file="fasta/c806.tab.seq.00727.out" FT /gene="SPAC1639.01c" FT /label=SPAC1639.01c FT /note="SPAC1639.01c, len:328, SIMILARITY:Saccharomyces FT italicus, AAB87766, v-snare bypass mutant., (347 aa), FT fasta scores: opt: 905, E():0, (49.2% identity in 309 aa)" FT /fasta_file="fasta/c1639.tab.seq.00716.out" FT CDS 228560..228907 FT /colour=9 FT /gene="SPAC13G6.13" FT /gene="SPAC24B11.02" FT /label=SPAC13G6.13 FT /note="SPAC13G6.13, len:115aa" FT /product="very hypothetical protein; low G+C" FT /fasta_file="fasta/c13G6.tab.seq.00470.out" FT /label=SPAC24B11.02 FT /note="SPAC24B11.02, len:115" FT /product="very hypothetical protein" FT /fasta_file="fasta/c24B11.tab.seq.00785.out" FT CDS complement(join(375515..375727,375790..375920, FT 375983..376115,376220..376294)) FT /colour=10 FT /gene="SPAC12G12.02" FT /gene="SPAC630.01c" FT /label=SPAC12G12.02 FT /note="SPAC12G12.02, len:183, SIMILARITY:Saccharomyces FT cerevisiae, YG5P_YEAST, hypothetical 17.9 kD protein in FT yta7-taf145 intergenic region., (152 aa), fasta scores: FT opt: 227, E():1.6e-07, (33.6% identity in 143 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGR272C" FT /fasta_file="fasta/c12G12.tab.seq.00564.out" FT /label=SPAC630.01c FT /note="SPAC630.01c, len:183, SIMILARITY:Saccharomyces FT cerevisiae, YG5P_YEAST, hypothetical 17.9 kD protein in FT yta7-taf145 intergenic region., (152 aa), fasta scores: FT opt: 284, E():4.7e-11, (36.6% identity in 131 aa)" FT /fasta_file="fasta/c630.tab.seq.01055.out" FT CDS 229911..230543 FT /colour=2 FT /gene="aps1" FT /gene="SPAC13G6.14" FT /gene="SPAC24B11.03" FT /label=aps1 FT /note="SPAC13G6.14, len:210aa" FT /product="diadenosine 5',5'''-p1,p6-hexaphosphate FT hydrolase; dual function MutT hydrolase; involved in FT inositol polyphosphate hydrolysis" FT /fasta_file="fasta/c13G6.tab.seq.00471.out" FT /note="SPAC24B11.03, len:210" FT /fasta_file="fasta/c24B11.tab.seq.00786.out" FT CDS complement(232163..232654) FT /colour=7 FT /gene="SPAC13G6.15c" FT /gene="SPAC24B11.04c" FT /label=SPAC13G6.15c FT /note="SPAC13G6.15c, len:163aa" FT /product="putative calcineurin-binding protein; Pfam- FT B_8791" FT /fasta_file="fasta/c13G6.tab.seq.00472.out" FT /label=SPAC24B11.04c FT /note="SPAC24B11.04c, len:163" FT /fasta_file="fasta/c24B11.tab.seq.00787.out" FT CDS complement(join(3471364..3471472,3471601..3471725, FT 3471804..3471874,3471925..3471964)) FT /colour=7 FT /gene="SPAC3H5.02" FT /gene="SPAC3A11.13" FT /label=SPAC3H5.02 FT /note="SPAC3H5.02, len:114aa; similarity: to YLR200W, FT KE2_Y EAST, P52553, protein yke2; nuclear, (114aa), fasta FT scores, opt:283, E():2.7e-20, (42.0% identity in 112 aa FT overlap)" FT /product="putative GIM complex; prefoldin subunit 6" FT /fasta_file="fasta/c3H5.tab.seq.01912.out" FT /label=SPAC3A11.13 FT /note="SPAC3A11.13, len:114, SIMILARITY:Saccharomyces FT cerevisiae, KE2_YEAST, protein yke2., (114 aa), fasta FT scores: opt: 283, E():2.2e-11, (42.0% identity in 112 aa)" FT /fasta_file="fasta/c3A11.tab.seq.01138.out" FT CDS join(260221..260357,260419..260475,260506..260812) FT /colour=8 FT /gene="SPAC24B11.14" FT /gene="SPAC806.10" FT /note="SPAC24B11.14, len:166" FT /note="added 3-9-99" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c24B11.tab.seq.00796.out" FT /note="SPAC806.10, len:166" FT /fasta_file="fasta/c806.tab.seq.00718.out" FT CDS 2703657..2704496 FT /colour=7 FT /gene="SPAC4F8.02c" FT /gene="SPAC644.02" FT /label=SPAC4F8.02c FT /note="SPAC4F8.02c, len:279, SIMILARITY:Saccharomyces FT cerevisiae, RM40_YEAST, mitochondrial 60s ribosomal FT protein l40, (297 aa), fasta scores: opt: 142, E():0.033, FT (24.2% identity in 277 aa)" FT /product="mitochondrial ribosomal protein L40 (L24); FT similar to S. cerevisiae MRPL40" FT /fasta_file="fasta/c4F8.tab.seq.00043.out" FT /label=SPAC644.02 FT /note="SPAC644.02, len:279, LOW SIMILARITY:Saccharomyces FT cerevisiae, RM40_YEAST, mitochondrial 60s ribosomal FT protein l40, (297 aa), fasta scores: opt: 142, E():0.045, FT (24.2% identity in 277 aa)" FT /product="putative mitochondrial ribosomal protein L40 FT (L24); similar to S. cerevisiae MRPL40" FT /fasta_file="fasta/c644.tab.seq.02121.out" FT CDS join(1007385..1007433,1007480..1007533,1007581..1007682, FT 1007725..1007865,1008009..1008313) FT /colour=2 FT /gene="meu13" FT /gene="SPAC222.15" FT /gene="SPAC821.01" FT /label=meu13 FT /note="SPAC222.15, len:216, SIMILARITY:Mus musculus, FT O35047, proteasome(prosome, macropain) 26s subunit, atpase FT 3, interacting protein(tbpip)., (217 aa), fasta scores: FT opt: 236, E():7.7e-07, (26.9% identity in 197 aa)" FT /note="originally annotated as a pseudogene because the FT third intron has a GAG acceptor, in 2 independently FT sequenced cosmids. But has Meiosis specific transcript FT disruption of which causes defect in meiosis. Personal FT communication Yasushi Hiraoka" FT /product="meiosis specific transcript; similar to S. FT cerevisiae HOP2; possibly required for pairing of FT homologous chromosomes in meiosis; meiotic expression FT upregulated ; mutant displays decreased recombination" FT /fasta_file="fasta/c222.tab.seq.00043.out" FT /product="meiosis specific transcript; similar to S. FT cerevisiae HOP2; possibly required for pairing of FT homologous chromosomes in meiosis; meiotic expression FT upregulated; mutant displays decreased recombination" FT /fasta_file="fasta/c821.tab.seq.00246.out" FT CDS 1579809..1580174 FT /colour=8 FT /fasta_file="fasta/c57A7.tab.seq.00038.out" FT /gene="SPAC57A7.02c" FT /gene="SPAC167.06c" FT /label=SPAC57A7.02c FT /note="SPAC57A7.02c, len:121" FT /product="hypothetical protein" FT /label=SPAC167.06c FT /note="SPAC167.06c, len:121" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c167.tab.seq.00127.out" FT CDS complement(join(2883467..2883473,2883526..2883596)) FT /colour=2 FT /gene="rpl41-2" FT /gene="SPAC3F10.18c" FT /gene="SPAC8F11.01c" FT /note="SPAC31F10.18c, len:25" FT /product="60S ribosomal protein L41" FT /fasta_file="fasta/c3F10.tab.seq.00613.out" FT /label=rpl41-2 FT /note="SPAC8F11.01c, len:25" FT /fasta_file="fasta/c8F11.tab.seq.01110.out" FT CDS complement(join(3657522..3657751,3657800..3658420, FT 3658461..3658563)) FT /colour=10 FT /gene="SPAC17G6.19c" FT /label=SPAC17G6.19c FT /note="SPAC17G6.19c, len:317, SIMILARITY:Caenorhabditis FT elegans., Q21746, similar to tpr domain repeats. ncbi gi: FT 1109816., (337 aa), fasta scores: opt: 505, E():3.2e-22, FT (30.8% identity in 321 aa)" FT /product="conserved protein; similar to S. cerevisiae FT SGT2; TPR domain repeats protein" FT /fasta_file="fasta/c17G6.tab.seq.01008.out" FT /gene="SPAC1142.02c" FT /label=SPAC1142.02c FT /note="SPAC1142.02c, len:317, SIMILARITY:Caenorhabditis FT elegans., Q21746, similar to tpr domain repeats. ncbi gi: FT 1109816., (337 aa), fasta scores: opt: 505, E():4.2e-22, FT (30.8% identity in 321 aa)" FT /fasta_file="fasta/c1142.tab.seq.02099.out" FT misc_feature 61144..61242 FT /note="Repeated region in SPAC1952 AL109820 S.pombe FT chromosome I cosmid c1952." FT misc_feature 61248..61350 FT /note="Repeated region from SPAC1952 AL109820 S.pombe FT chromosome I cosmid c1952." FT misc_feature 61410..61527 FT /note="Repeated region from SPAC1952 AL109820 S.pombe FT chromosome I cosmid c1952." FT misc_feature 61704..61948 FT /note="Repeated region from SPAC1952 AL109820 S.pombe FT chromosome I cosmid c1952." FT CDS 61906..62346 FT /colour=12 FT /gene="SPAC977.02" FT /label=SPAC977.02 FT /note="SPAC977.02, len:146" FT /product="hypothetical protein; overlaps a region FT duplicated in c1952 which has no ORF; possibly S. pombe FT specific; telomeric duplication" FT /fasta_file="fasta/c977.tab.seq.00281.out" FT misc_feature 61912..62026 FT /note="Repeated region from SPAC1952 AL109820 S.pombe FT chromosome I cosmid c1952." FT LTR complement(62539..62733) FT /note="Tf2-type LTR" FT CDS 63511..63948 FT /colour=10 FT /gene="SPAC977.03" FT /label=SPAC977.03 FT /note="SPAC977.03, len:145, LOW SIMILARITY:Mycobacterium FT tuberculosis., P71805, hypothetical 22.8 kD protein., (212 FT aa), fasta scores: opt: 241, E():4.6e-10, (37.6% identity FT in 109 aa)" FT /product="putative methyltransferase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c977.tab.seq.00070.out" FT CDS 63974..64492 FT /colour=4 FT /gene="SPAC977.04" FT /label=SPAC977.04 FT /note="SPAC977.04, len:172, SIMILARITY to c-term FT of:Candida albicans, O93992, hypothetical membrane FT protein., (510 aa), fasta scores: opt: 345, E():5.8e-17, FT (38.5% identity in 148 aa)" FT /note="5' end of gene missing. Full length gene found in FT cosmid c1348 13572 - 15029. Possible deletion between FT SPAC977.03 and SPAC977.04 (maybe as telomeric)" FT /product="putative membrane transporter possibly pseudo" FT /pseudo FT /fasta_file="fasta/c977.tab.seq.00283.out" FT CDS complement(65444..66058) FT /colour=10 FT /gene="SPAC977.05c" FT /label=SPAC977.05c FT /note="SPAC977.05c, len:249, SIMILARITY:Saccharomyces FT cerevisiae, Q08910, chromosome xv reading frame orf FT yor387c., (206 aa), fasta scores: opt: 788, E():0, (54.1% FT identity in 205 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOR387C; predicted N-terminal signal sequence" FT /fasta_file="fasta/c977.tab.seq.00284.out" FT CDS join(69107..69524,69575..69726) FT /colour=12 FT /gene="SPAC977.06" FT /label=SPAC977.06 FT /note="SPAC977.06, len:189" FT /product="hypothetical protein; possibly S. pombe FT specific; similar to S. pombe SPAC1348.07, SPAC1348.01, FT SPAC750.06, and SPAC212.01" FT /fasta_file="fasta/c977.tab.seq.00285.out" FT misc_feature 69525..69530 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 69558..69574 FT /colour=6 FT /note="ctaataatttaaaatag, splice branch and acceptor" FT misc_feature complement(70880..71095) FT /fasta_file="fasta/c977.tab.seq.00053.out" FT /note="putative pseudo" FT CDS complement(71733..72983) FT /colour=12 FT /gene="SPAC977.07c" FT /label=SPAC977.07c FT /note="SPAC977.07c, len:416, FT SIMILARITY:Schizosaccharomyces pombe, YAH2_SCHPO, FT hypothetical 62.9 kD protein c8a4.02c in chromosome i., FT (609 aa), fasta scores: opt: 1354, E():0, (56.3% identity FT in 378 aa)" FT /product="hypothetical serine-threonine repeat protein; FT possibly S. pombe specific; predicted N-terminal signal FT sequence" FT /fasta_file="fasta/c977.tab.seq.00286.out" FT CDS 74380..75090 FT /colour=7 FT /gene="SPAC977.08" FT /label=SPAC977.08 FT /note="SPAC977.08, len:236, SIMILARITY:Burkholderia FT cepacia, Q51641, insect-type dehydrogenase., (249 aa), FT fasta scores: opt: 371, E():6.4e-17, (32.1% identity in FT 221 aa)" FT /product="putative short chain dehydrogenase" FT /fasta_file="fasta/c977.tab.seq.00287.out" FT CDS complement(join(75751..75819,75884..77836)) FT /colour=7 FT /gene="SPAC977.09c" FT /label=SPAC977.09c FT /note="SPAC977.09c, len:673, FT SIMILARITY:Schizosaccharomyces pombe, O13857, putative FT lysophospholipase , (624 aa), fasta scores: opt: 3142, FT E():0, (74.7% identity in 598 aa)" FT /product="putative lysophospholipase" FT /fasta_file="fasta/c977.tab.seq.00288.out" FT misc_feature complement(75820..75835) FT /colour=6 FT /note="ctaacttttgttctag, splice branch and acceptor" FT misc_feature complement(75878..75883) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(75887..77698) FT /note="Match to PF01735 PLA2_B, Lysophospholipase FT catalytic domain Score 1033.69" FT CDS join(81793..81916,81994..83276) FT /colour=2 FT /gene="sod2" FT /gene="SPAC977.10" FT /label=sod2 FT /note="SPAC977.10, len:468" FT /product="CPA1 sodium ion/proton antiporter" FT /fasta_file="fasta/c977.tab.seq.00289.out" FT misc_feature 81917..81922 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 81977..81993 FT /colour=6 FT /note="ctaatactagtgtgtag, splice branch and acceptor" FT LTR 84175..84530 FT /note="Tf1-type LTR" FT misc_feature 84940..87590 FT /note="region duplicated in pB8B6 S. pombe chromosome 1" FT CDS 84950..85885 FT /colour=10 FT /gene="SPAC977.11" FT /label=SPAC977.11 FT /note="SPAC977.11, len:311, SIMILARITY:Saccharomyces FT cerevisiae, Q08913, chromosome xv reading frame orf FT yor390w., (375 aa), fasta scores: opt: 153, E():0.0032, FT (30.4% identity in 355 aa)" FT /product="hypothetical protein; duplicated in S. pombe; FT identical to S. pombe SPAPB8B6.??; similar to S. FT cerevisiae YOR390W; predicted transmembrane" FT /fasta_file="fasta/c977.tab.seq.00072.out" FT CDS 86168..87238 FT /colour=7 FT /gene="SPAC977.12" FT /label=SPAC977.12 FT /note="SPAC977.12, len:356, SIMILARITY:Schizosaccharomyces FT pombe, P87015, l-asparaginase ., (360 aa), fasta scores: FT opt: 1521, E():0, (73.6% identity in 314 aa)" FT /product="putative L-asparaginase" FT /fasta_file="fasta/c977.tab.seq.00073.out" FT misc_feature 86303..87199 FT /note="Match to PF00710 Asparaginase, Asparaginase Score FT 350.53" FT CDS complement(87953..88781) FT /colour=4 FT /gene="SPAC977.13c" FT /label=SPAC977.13c FT /note="SPAC977.13c, len:276, SIMILARITY:Synechocystis s, FT P7359, hypothetical 32.9 kD protein., (295 aa), fasta FT scores: opt: 280, E(): 3.1e-12, (25.8% identity in 275 aa)" FT /product="putative hydrolase pseudogene" FT /pseudo FT /fasta_file="fasta/c977.tab.seq.00292.out" FT misc_feature complement(join(87953..88255,88483..88641,88644..88781)) FT /note="putative pseudogene" FT /note="regions with homology to hydrolase" FT intron 3471039..3471163 FT /colour=2 FT /note="confirmed intron" FT intron complement(3471473..3471600) FT /colour=2 FT /note="confirmed intron" FT intron complement(3471726..3471803) FT /colour=2 FT /note="confirmed intron" FT tRNA complement(2832438..2832535) FT /note="tRNA Leu anticodon TAA, Cove score 44.02" FT intron complement(2832482..2832497) FT /note="intron tRNA Leu anticodon TAA" FT tRNA 3472732..3472821 FT /note="tRNA Arg anticodon CCG, Cove score 40.63" FT intron complement(2883474..2883525) FT /colour=2 FT /note="confirmed intron" FT repeat_region 89112..89162 FT /label={ttattttaagttttgtc}3 FT /note="(ttattttaagttttgtc)3" FT misc_feature complement(89280..90468) FT /note="region duplicated in SPAC750 S. pombe chromosome FT 1; appears to be pseudo in c750 as CDS has no initiator FT methionine" FT CDS complement(89391..90446) FT /colour=7 FT /gene="SPAC977.14c" FT /label=SPAC977.14c FT /note="SPAC977.14c, len:351, SIMILARITY:Saccharomyces FT cerevisiae, Q02895, lpg20p., (342 aa), fasta scores: opt: FT 1168, E():0, (52.7% identity in 334 aa)" FT /product="putative oxidoreductase" FT /fasta_file="fasta/c977.tab.seq.00071.out" FT CDS 92665..93408 FT /colour=7 FT /gene="SPAC977.15" FT /label=SPAC977.15 FT /note="SPAC977.15, len:247, SIMILARITY:Schizosaccharomyces FT pombe, YB4E_SCHPO, hypothetical 27.4 kD protein c30d10.14 FT in chromosome ii., (249 aa), fasta scores: opt: 935, E():0, FT (53.5% identity in 245 aa)" FT /product="putative hydrolase" FT /fasta_file="fasta/c977.tab.seq.00294.out" FT CDS complement(94580..96355) FT /EC_number="2.7.1.29" FT /colour=2 FT /gene="dak2" FT /gene="SPAC977.16c" FT /label=dak2 FT /note="SPAC977.16c, len:591" FT /product="dihydroxyacetone kinase" FT /fasta_file="fasta/c977.tab.seq.00295.out" FT CDS 96819..98615 FT /colour=7 FT /gene="SPAC977.17" FT /label=SPAC977.17 FT /note="SPAC977.17, len:598, SIMILARITY:Saccharomyces FT cerevisiae, YFF4_YEAST, hypothetical 70.5 kD protein in FT agp3-dak3 intergenic region., (646 aa), fasta scores: opt: FT 1869, E():0, (52.1% identity in 560 aa)" FT /product="MIP water channel" FT /fasta_file="fasta/c977.tab.seq.00296.out" FT misc_feature 97743..98462 FT /note="Match to PF00230 MIP, Major intrinsic protein Score FT 204.02" FT misc_feature 100152..100254 FT /note="nominal overlap with PCR product SPAPJ695, FT EM:AL132983 S. pombe chromosome 1" FT misc_feature 100152..100254 FT /note="nominal overlap with cosmid SPAC977, EM:AL137130 S. FT pombe chromosome 1" FT misc_RNA 102020..102090 FT /note="Small duplicated region as identified by FT independent cDNAs AU009231 cDNA, clone and spc04643 FT AU009540, clone spc05042, also shows 78/95 FT (82%)conservation between SPAC4F8 Z98530 S.pombe FT chromosome I cosmid c4F8, and 84/95 (88%) conservation FT between MISPLSUR X06597 Fission yeast mtDNA for LSU rRNA FT gene" FT LTR complement(103385..103653) FT /note="TF2 type LTR fragment" FT LTR 103621..103958 FT /note="TF2 type LTR fragment" FT CDS complement(107254..107607) FT /colour=12 FT /gene="SPAPJ695.01c" FT /label=SPAPJ695.01c FT /note="SPAPJ695.01c, len:117, FT SIMILARITY:Schizosaccharomyces pombe, CAB42063, FT hypothetical 12.8 kD protein., (113 aa), fasta scores: FT opt: 506, E():7.7e-29, (67.3% identity in 113 aa)" FT /product="hypothetical protein; possibly S. pombe FT specific; similar to S. pombe SPCC569.02 and SPCP20C8.02; FT predicted N-terminal signal sequence" FT /fasta_file="fasta/pJ695.tab.seq.00305.out" FT misc_RNA 109219..109304 FT /note="Small duplicated region as marked by 2 independent FT cDNAs AU010317 clone spc05710 and AU007551 clone spc02188, FT also hits 4376 4461 MISPCG X54421 S. pombe complete FT mitochondrial genome and MISPRNS X15738 Fission yeast FT mitDNA for small ribosomal RNA" FT LTR complement(109356..109444) FT /note="fragment" FT misc_feature 110458..110561 FT /note="nominal overlap with cosmid SPAC1F8, EM:Z81312 S. FT pombe chromosome 1" FT misc_feature 110458..110561 FT /note="nominal overlap with PCR product pJ695, EM:AL132983 FT S. pombe chromosome 1" FT CDS 112612..114279 FT /colour=2 FT /gene="ght3" FT /gene="SPAC1F8.01" FT /label=ght3 FT /note="SPAC1F8.01, len:555" FT /product="MFS glucose transporter" FT /fasta_file="fasta/c1F8.tab.seq.00762.out" FT misc_feature 112636..114012 FT /note="Match to PF00083 sugar_tr, Sugar (and other) FT transporter Score 437.58" FT misc_feature 112966..113043 FT /colour=8 FT /note="PS00217 Sugar transport proteins signature 2" FT misc_feature 113563..113616 FT /colour=8 FT /note="PS00216 Sugar transport proteins signature 1" FT CDS complement(115274..115954) FT /colour=8 FT /gene="SPAC1F8.02c" FT /label=SPAC1F8.02c FT /note="SPAC1F8.02c, unknown, len: 226" FT /product="hypothetical protein; sequence orphan; contains FT predicted N-terminal signal sequence" FT /fasta_file="fasta/c1F8.tab.seq.00763.out" FT CDS complement(118043..119935) FT /colour=7 FT /gene="SPAC1F8.03c" FT /label=SPAC1F8.03c FT /note="SPAC1F8.03c, len:630, FT SIMILARITY:Schizosaccharomyces pombe, O94607, putative FT major facilitator family protein., (597 aa), fasta scores: FT opt: 752, E():0, (27.4% identity in 580 aa)" FT /product="MFS transporter of unknown specificity" FT /fasta_file="fasta/c1F8.tab.seq.00764.out" FT CDS complement(122156..123547) FT /colour=7 FT /gene="SPAC1F8.04c" FT /label=SPAC1F8.04c FT /note="SPAC1F8.04c, len:463, SIMILARITY:Pseudomonas sp., FT ATZA_PSESD, atrazine chlorohydrolase, (474 aa), fasta FT scores: opt: 730, E():0, (30.5% identity in 476 aa)" FT /product="putative chlorohydrolase/deaminase; putative FT guanine deaminase" FT /fasta_file="fasta/c1F8.tab.seq.00765.out" FT CDS 125676..126224 FT /colour=2 FT /gene="isp3" FT /gene="meu4" FT /gene="SPAC1F8.05" FT /label=isp3 FT /note="SPAC1F8.05, len:182 PROEIN CODING EVIDENCE. FT STRANGEPLOT AND COMP. RNA?" FT /product="sexual differentiation process protein; meiotic FT expression upregulated; no apparent orthologs" FT /fasta_file="fasta/c1F8.tab.seq.00018.out" FT misc_RNA 128420..128527 FT /colour=3 FT /note="mRNA from AU012843 101 208 but not associated with FT a CDS" FT CDS 129687..130844 FT /colour=12 FT /gene="SPAC1F8.06" FT /label=SPAC1F8.06 FT /note="SPAC1F8.06, len:385, SIMILARITY to C-term FT :Schizosaccharomyces pombe, YAH2_SCHPO, hypothetical 62.9 FT kD protein c8a4.02c in chromosome i., (609 aa), fasta FT scores: opt: 1080, E():0, (47.2% identity in 379 aa)" FT /product="hypothetical serine-rich protein; similar to S. FT pombe SPAC8A4.02C and SPAC977.07C; putative cell surface FT protein; possibly S. pombe specific; predicted N-terminal FT signal sequence" FT /fasta_file="fasta/c1F8.tab.seq.00767.out" FT CDS complement(131436..133220) FT /EC_number="4.1.1.1" FT /colour=7 FT /gene="SPAC1F8.07c" FT /label=SPAC1F8.07c FT /note="SPAC1F8.07c, len:594, SIMILARITY:Neurospora crassa., FT DCPY_NEUCR, pyruvate decarboxylase, (570 aa), fasta FT scores: opt: 2196, E():0, (56.9% identity in 559 aa)" FT /product="putative pyruvate decarboxylase" FT /fasta_file="fasta/c1F8.tab.seq.00768.out" FT misc_feature complement(131604..133166) FT /note="Match to PF00205 TPP_enzymes, Thiamine FT pyrophosphate enzymes Score 572.17" FT misc_feature complement(131877..131936) FT /colour=8 FT /note="PS00187 Thiamine pyrophosphate enzymes signature" FT CDS 133617..133979 FT /colour=8 FT /gene="SPAC1F8.08" FT /label=SPAC1F8.08 FT /note="SPAC1F8.08, len:121" FT /product="hypothetical protein; possible transmembrane" FT /fasta_file="fasta/c1F8.tab.seq.00019.out" FT misc_feature 136832..136837 FT /note="nominal overlap with cosmid SPAC11D3, EM:Z68166 S. FT pombe chromosome I" FT misc_feature 136832..136837 FT /note="nominal overlap with cosmid SPAC1F8 EM:Z81312 FT S.pombe chromosome 1" FT CDS complement(138584..138823) FT /colour=10 FT /gene="SPAC11D3.01c" FT /label=SPAC11D3.01c FT /note="SPAC11D3.01c, len:79, SIMILARITY:Neurospora crassa., FT CON6_NEUCR, conidiation-specific protein 6., (93 aa), FT fasta scores: opt: 173, E():9.9e-06, (52.9% identity in 87 FT aa)" FT /product=" similar to neurospora conidiation specific FT protein; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c11D3.tab.seq.01584.out" FT CDS complement(139505..139957) FT /colour=7 FT /gene="SPAC11D3.02c" FT /label=SPAC11D3.02c FT /note="SPAC11D3.02c, len:150, SIMILARITY:Escherichia coli., FT ELAA_ECOLI, elaa protein., (153 aa), fasta scores: opt: FT 288, E():1.2e-13, (38.2% identity in 144 aa)" FT /product="ELLA family protein; putative acetyl FT transferase; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c11D3.tab.seq.01585.out" FT misc_feature complement(139568..139915) FT /note="Match to PF00583 Acetyltransf, Acetyltransferase FT (GNAT) family Score 94.95" FT CDS complement(140681..141589) FT /colour=10 FT /gene="SPAC11D3.03c" FT /label=SPAC11D3.03c FT /note="SPAC11D3.03c, len:302" FT /product="conserved protein; similar to CG10208; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c11D3.tab.seq.01586.out" FT CDS complement(142593..142985) FT /colour=8 FT /gene="SPAC11D3.04c" FT /label=SPAC11D3.04c FT /note="SPAC11D3.04c, len:130" FT /product="hypothetical protein; sequence orphan; has FT expression on microarray" FT /fasta_file="fasta/c11D3.tab.seq.01587.out" FT CDS 143756..145396 FT /colour=7 FT /gene="SPAC11D3.05" FT /label=SPAC11D3.05 FT /note="SPAC11D3.05, len:546, FT SIMILARITY:Schizosaccharomyces pombe, O59738, major FT facilitator family protein., (541 aa), fasta scores: opt: FT 2464, E():0, (65.9% identity in 548 aa)" FT /product="MFS drug efflux transporter of unknown FT specificity" FT /fasta_file="fasta/c11D3.tab.seq.01588.out" FT CDS 146369..147736 FT /colour=7 FT /gene="SPAC11D3.06" FT /label=SPAC11D3.06 FT /note="SPAC11D3.06, len:455, SIMILARITY:Saccharomyces FT cerevisiae, YD38_YEAST, hypothetical 77.8 kD protein. (695 FT aa), fasta scores: opt: 965, E():0, (36.5% identity in 433 FT aa)" FT /product="MATE family transporter of unknown specificity" FT /fasta_file="fasta/c11D3.tab.seq.01589.out" FT CDS complement(join(147871..149503,149606..149784)) FT /colour=7 FT /gene="SPAC11D3.07c" FT /label=SPAC11D3.07c FT /note="SPAC11D3.07c, len:603, FT SIMILARITY:Schizosaccharomyces pombe, O94573, putative FT transcriptional regulator, zinc finger, binuclear FT clusterdomain containing., (595 aa), fasta scores: opt: FT 1180, E():0, (35.1% identity in 619 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; fungal binuclear cluster domain" FT /fasta_file="fasta/c11D3.tab.seq.01590.out" FT misc_feature complement(149683..149769) FT /colour=8 FT /note="PS00463 fungal Zn(2)-Cys(6) binuclear cluster FT domain" FT CDS complement(150232..151884) FT /colour=7 FT /gene="SPAC11D3.08c" FT /label=SPAC11D3.08c FT /note="SPAC11D3.08c, len:550, SIMILARITY:Saccharomyces FT cerevisiae, UGA4_YEAST, gaba-specific permease, (571 aa), FT fasta scores: opt: 1009, E():0, (32.8% identity in 524 aa)" FT /product="APC amino acid transporter" FT /fasta_file="fasta/c11D3.tab.seq.01591.out" FT CDS 152521..153705 FT /EC_number="3.5.3.11" FT /colour=7 FT /gene="SPAC11D3.09" FT /label=SPAC11D3.09 FT /note="SPAC11D3.09, len:394, FT SIMILARITY:Schizosaccharomyces pombe, O42887, arginase FT family protein., (413 aa), fasta scores: opt: 815, E():0, FT (50.4% identity in 389 aa)" FT /product="arginase family protein; putative agmatinase; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c11D3.tab.seq.01592.out" FT misc_feature 152755..152826 FT /note="Match to PF00491 arginase, Arginase family Score FT 34.60" FT misc_feature 153052..153159 FT /note="Match to PF00491 arginase, Arginase family Score FT 20.36" FT misc_feature 153334..153582 FT /note="Match to PF00491 arginase, Arginase family Score FT 94.68" FT CDS 155258..156562 FT /colour=7 FT /gene="SPAC11D3.10" FT /label=SPAC11D3.10 FT /note="SPAC11D3.10, len:434, FT SIMILARITY:Schizosaccharomyces pombe, O74542, nifs homolog, FT putative aminotransferase., (396 aa), fasta scores: opt: FT 1603, E():0, (58.5% identity in 390 aa)" FT /product="nifS homolog, putative aminotransferase" FT /fasta_file="fasta/c11D3.tab.seq.01593.out" FT CDS complement(join(156841..157704,157704..158735, FT 158779..158803,158848..158861)) FT /colour=4 FT /gene="SPAC11D3.11c" FT /gene="SPAC11D3.12c" FT /label=SPAC11D3.11c FT /note="SPAC11D3.11c, len:644, FT SIMILARITY:Schizosaccharomyces pombe, O74915, putative FT transcriptional activator, zinc finger containing., (684 FT aa), fasta scores: opt: 1914, E():0, (46.9% identity in FT 616 aa)" FT /product="putative transcriptional activator; zinc finger FT protein" FT /pseudo FT /fasta_file="fasta/c11D3.tab.seq.01594.out" FT misc_feature 157701..157811 FT /note="PCR verified framshift in 972h-" FT misc_feature complement(158667..158744) FT /note="Match to PF00172 Zn_clus, fungal Zn(2)-Cys(6) FT binuclear cluster domain Score 38.71" FT misc_feature complement(158736..158751) FT /colour=2 FT /note=" putative splice branch and acceptor sequence, FT ctaac tacaattaaag" FT misc_feature complement(158773..158778) FT /colour=2 FT /note=" putative splice donor sequence, gtattc" FT misc_feature complement(158804..158820) FT /colour=2 FT /note=" putative splice branch and acceptor sequence, FT tacta accaatatctag" FT misc_feature complement(158842..158847) FT /colour=2 FT /note=" putative splice donor sequence, gtaagg" FT CDS 160005..160673 FT /colour=10 FT /gene="SPAC11D3.13" FT /label=SPAC11D3.13 FT /note="SPAC11D3.13, len:222, FT SIMILARITY:Schizosaccharomyces pombe, O43084, hypothetical FT 28.5 kD protein., (261 aa), fasta scores: opt: 617, FT E():9.2e-33, (50.8% identity in 181 aa)" FT /product="conserved protein; contains ThiJ domain" FT /fasta_file="fasta/c11D3.tab.seq.01595.out" FT CDS complement(160995..164777) FT /colour=7 FT /gene="SPAC11D3.14c" FT /label=SPAC11D3.14c FT /note="SPAC11D3.14, len:1260, SIMILARITY:Rattus norvegicus, FT OPLA_RAT, 5-oxoprolinase, (1288 aa), fasta scores: opt: FT 4011, E():0, (50.6% identity in 1272 aa)" FT /product="putative oxoprolinase" FT /fasta_file="fasta/c11D3.tab.seq.01596.out" FT misc_feature 165254 FT /note="true left end of c5H10" FT CDS 166007..169960 FT /colour=7 FT /gene="SPAC11D3.15" FT /label=SPAC11D3.15 FT /note="SPAC11D3.15, len:1317, SIMILARITY:Saccharomyces FT cerevisiae, YKV5_YEAST, hypothetical 140.4 kD protein in FT ura1-doa1 intergenic region., (1286 aa), fasta scores: FT opt: 4764, E():0, (57.3% identity in 1296 aa)" FT /product="putative oxoprolinase" FT /fasta_file="fasta/c11D3.tab.seq.01597.out" FT CDS complement(170481..170876) FT /colour=8 FT /gene="SPAC11D3.16c" FT /label=SPAC11D3.16c FT /note="SPAC11D3.16c, len:131" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c11D3.tab.seq.01598.out" FT CDS 172351..174108 FT /colour=7 FT /gene="SPAC11D3.17" FT /label=SPAC11D3.17 FT /note="SPAC11D3.17, len:585, SIMILARITY:Drosophila FT melanogaster, BTD_DROME, transcription factor btd, (644 FT aa), fasta scores: opt: 195, E():1.9e-05, (27.3% identity FT in 154 aa)" FT /product="zinc finger protein; zf-C2H2 type" FT /fasta_file="fasta/c11D3.tab.seq.01599.out" FT misc_feature 172447..172509 FT /colour=8 FT /note="PS00028 zinc finger, C2H2 type, domain" FT misc_feature 172531..172596 FT /colour=8 FT /note="PS00028 zinc finger, C2H2 type, domain" FT CDS complement(174538..176034) FT /colour=7 FT /gene="SPAC11D3.18c" FT /label=SPAC11D3.18c FT /note="SPAC11D3.18c, len:498, SIMILARITY:Saccharomyces FT cerevisiae, YG5H_YEAST, putative transporter ygr260w., FT (534 aa), fasta scores: opt: 1035, E():0, (34.0% identity FT in 483 aa)" FT /product="MFS transporter of unknown specificity" FT /fasta_file="fasta/c11D3.tab.seq.01600.out" FT misc_feature 176118..176123 FT /note="nominal overlap with cosmid SPAC5H10, EM:Z49811 FT S.pombe chromosome 1" FT misc_feature 176118..176123 FT /note="nominal overlap with cosmid SPAC11D3, EM:Z68166 FT S.pombe chromosome 1" FT CDS 176650..177555 FT /colour=10 FT /gene="SPAC5H10.01" FT /note="SPAC5H10.01, len:301, SIMILARITY:Bacillus subtilis., FT YCSI_BACSU, hypothetical 28.1 kD protein, (257 aa), FT fasta scores: opt: 723, E():0, (45.1% identity in 253 aa)" FT /product="hypothetical protein; Pfam-B:PB028175; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c5H10.tab.seq.01762.out" FT CDS complement(177889..178611) FT /colour=10 FT /gene="SPAC5H10.02c" FT /note="SPAC5H10.02c, len:240, FT SIMILARITY:Schizosaccharomyces pombe, O74914, conserved FT hypothetical protein, (244 aa), fasta scores: opt: 986, FT E():0, (60.7% identity in 234 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YPL280W" FT /fasta_file="fasta/c5H10.tab.seq.01763.out" FT rRNA 179334..179452 FT /gene="5SrRNA" FT /note="5S rRNA gene" FT /product="5SrRNA" FT CDS 181589..182248 FT /colour=7 FT /gene="SPAC5H10.03" FT /note="SPAC5H10.03, len:219, FT SIMILARITY:Schizosaccharomyces pombe, CAB58725, FT hypothetical 25.2 kD protein., (216 aa), fasta scores: FT opt: 479, E():4.5e-25, (35.6% identity in 205 aa)" FT /product="putative phosphoglycerate mutase" FT /fasta_file="fasta/c5H10.tab.seq.01764.out" FT misc_feature 181619..181648 FT /note="PS00175 Phosphoglycerate mutase family FT phosphohistidine signature" FT CDS 183063..184211 FT /EC_number="1.6.99.1" FT /colour=7 FT /gene="SPAC5H10.04" FT /note="SPAC5H10.04, len:382, FT SIMILARITY:Schizosaccharomyces pombe, OYEB_SCHPO, putative FT nadph dehydrogenase c5h10.10, (392 aa), fasta scores: opt: FT 1542, E():0, (57.5% identity in 381 aa)" FT /product="putative NADPH dehydrogenase" FT /fasta_file="fasta/c5H10.tab.seq.01765.out" FT misc_feature 183078..184121 FT /note="Match to oxidored_FMN , Score 649.99" FT CDS complement(184483..185073) FT /colour=7 FT /gene="SPAC5H10.05c" FT /note="SPAC5H10.05c, len:196, SIMILARITY:Escherichia coli., FT MDAB_ECOLI, modulator of drug activity b., (193 aa), FT fasta scores: opt: 778, E():0, (56.8% identity in 190 aa)" FT /product="NADHdh_2 domain protein; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c5H10.tab.seq.01766.out" FT CDS complement(186224..187492) FT /EC_number="1.1.1.1" FT /colour=7 FT /gene="SPAC5H10.06c" FT /note="SPAC5H10.06c, len:422, SIMILARITY:Saccharomyces FT cerevisiae, ADH4_YEAST, alcohol dehydrogenase iv, (465 aa), FT fasta scores: opt: 1511, E():0, (55.7% identity in 415 FT aa)" FT /product="iron containing alcohol dehydrogenase" FT /fasta_file="fasta/c5H10.tab.seq.01767.out" FT misc_feature complement(186251..187339) FT /note="Pfam match to entry Fe-ADH PF00465, Iron-containing FT alcohol dehydrogenases" FT misc_feature complement(186530..186577) FT /note="PS00060 Iron-containing alcohol dehydrogenases FT signature 2" FT misc_feature complement(186761..186856) FT /note="PS00913 Iron-containing alcohol dehydrogenases FT signature 1" FT CDS 188879..189148 FT /colour=8 FT /gene="SPAC5H10.07" FT /note="SPAC5H10.07, len:89" FT /note="putative est" FT /product="hypothetical protein; sequence orphan; has EST" FT /fasta_file="fasta/c5H10.tab.seq.01768.out" FT CDS complement(189770..190621) FT /EC_number="6.3.2.1" FT /colour=7 FT /gene="SPAC5H10.08c" FT /note="SPAC5H10.08c, putative pantoate--beta-alanine FT ligase len: 283, similar to SW:PANC_ECOLI P31663 pantoate-- FT beta-alanine ligase, (59.6% identity in 277 aa overlap)" FT /note="SPAC5H10.08c, len:283, SIMILARITY:Escherichia coli., FT PANC_ECOLI, pantoate--beta-alanine ligase, (283 aa), FT fasta scores: opt: 1105, E():0, (59.6% identity in 277 aa)" FT /product="putative pantoate--beta-alanine ligase" FT /fasta_file="fasta/c5H10.tab.seq.01769.out" FT CDS complement(190653..191456) FT /EC_number="2.1.2.11" FT /colour=7 FT /gene="SPAC5H10.09c" FT /note="SPAC5H10.09c, putative 3-methyl-2-oxobutanoate FT hydroxymethyltransferase, len: 267, similar to FT SW:PANB_ECOLI, P31057, 3-methyl-2-oxobutanoate FT hydroxymethyltransferase (67.9% identity in 265 aa FT overlap)" FT /note="SPAC5H10.09c, len:267, SIMILARITY:Escherichia coli., FT PANB_ECOLI, 3-methyl-2-oxobutanoate FT hydroxymethyltransferase, (264 aa), fasta scores: opt: FT 1180, E():0, (67.9% identity in 265 aa)" FT /product="putative 3-methyl-2-oxobutanoate FT hydroxymethyltransferase" FT /fasta_file="fasta/c5H10.tab.seq.01770.out" FT CDS 192636..193814 FT /EC_number="1.6.99.1" FT /colour=7 FT /gene="SPAC5H10.10" FT /note="SPAC5H10.10, len:392, FT SIMILARITY:Schizosaccharomyces pombe, OYEA_SCHPO, putative FT nadph dehydrogenase c5h10.04, (382 aa), fasta scores: opt: FT 1542, E():0, (57.5% identity in 381 aa)" FT /product="putative NADPH dehydrogenase" FT /fasta_file="fasta/c5H10.tab.seq.01771.out" FT misc_feature 192669..193715 FT /note="Match to oxidored_FMN , Score 648.36" FT CDS 194404..195393 FT /colour=7 FT /gene="gmh1" FT /gene="SPAC5H10.11" FT /label=gmh1 FT /note="SPAC5H10.11, len:329, FT SIMILARITY:Schizosaccharomyces pombe, YDB6_SCHPO, FT hypothetical 38.1 kD protein c22e12.06c in chromosome i., FT (332 aa), fasta scores: opt: 1068, E():0, (47.9% identity FT in 317 aa)" FT /product="putative galactosyltransferase; high similarity FT to Gmh3p, an alpha-1,2-galactosyltransferase" FT /fasta_file="fasta/c5H10.tab.seq.01772.out" FT CDS complement(196096..197211) FT /colour=12 FT /gene="B20341-3" FT /gene="SPAC5H10.12c" FT /label=B20341-3 FT /note="SPAC5H10.12c, len:371, FT SIMILARITY:Schizosaccharomyces pombe, O43062, hypothetical FT 44.1 kD protein., (376 aa), fasta scores: opt: 1288, E():0, FT (49.1% identity in 373 aa)" FT /note="putative gatactosyltransferase" FT /product="Pfam-B_20341; possibly S. pombe specific" FT /fasta_file="fasta/c5H10.tab.seq.01773.out" FT CDS complement(198486..199526) FT /colour=7 FT /gene="gmh2" FT /gene="SPAC5H10.13c" FT /note="SPAC5H10.13c, len:346, FT SIMILARITY:Schizosaccharomyces pombe, YA0B_SCHPO, putative FT galactosyltransferase, (329 aa), fasta scores: opt: 1016, FT E():0, (47.3% identity in 332 aa)" FT /product="putative galactosyltransferase; similar to Gmh3p, FT an alpha-1,2-galactosyltransferase" FT /fasta_file="fasta/c5H10.tab.seq.01774.out" FT misc_feature complement(200816..200959) FT /note="Match to helicase_C , Score 32.43" FT misc_feature 200838..200962 FT /note="nominal overlap with cosmid SPAC13G6, EM:Z54308 FT S.pombe chromosome 1" FT misc_feature 200838..200962 FT /note="overlap with cosmid SPAC5H10, EM:Z49811 S.pombe FT chromosome 1" FT misc_feature complement(200840..201067) FT /colour=9 FT /note="Pfam match to entry PF00271 helicase_C, Helicases FT co nserved C-terminal domain" FT misc_feature complement(201284..201421) FT /colour=9 FT /note="Pfam match to entry PF00097 zf-C3HC4, zinc finger, FT C 3HC4 type (RING finger)" FT misc_feature complement(201581..201775) FT /colour=9 FT /note="Pfam match to entry PF00176 SNF2_N, SNF2 and others FT N-terminal domain" FT misc_feature complement(201947..202180) FT /colour=9 FT /note="Pfam match to entry PF00176 SNF2_N, SNF2 and others FT N-terminal domain" FT misc_feature complement(202289..202708) FT /colour=9 FT /note="Pfam match to entry PF00176 SNF2_N, SNF2 and others FT N-terminal domain" FT CDS complement(204689..205447) FT /colour=2 FT /gene="rps3a-1" FT /gene="rps1-1" FT /gene="SPAC13G6.02c" FT /label=rps1-1 FT /note="SPAC13G6.02c, len:252aa" FT /product="40S ribosomal protein S3a(S1)" FT /fasta_file="fasta/c13G6.tab.seq.00459.out" FT misc_feature complement(204782..205417) FT /colour=9 FT /note="Pfam match to entry PF01015 Ribosomal_S3Ae, FT Ribosomal S3Ae family, score 497.60, E-value 9.3e-146" FT promoter complement(205502..205509) FT /colour=4 FT /note="Homol D box" FT CDS 206968..209244 FT /colour=7 FT /gene="SPAC13G6.03" FT /label=SPAC13G6.03 FT /note="SPAC13G6.03, len:758, SIMILARITY:Caenorhabditis FT elegans, Q19870, f28c6.4 protein, (795 aa), fasta scores: FT opt: 1049, E():0, (33.4% identity in 709 aa)" FT /product="putative glycosylphospatidylinositol FT modification by similar to las21" FT /fasta_file="fasta/c13G6.tab.seq.00460.out" FT CDS join(210099..210204,210262..210452) FT /colour=2 FT /gene="tim8" FT /gene="SPAC13G6.04" FT /label=tim8 FT /note="SPAC13G6.04, len:98aa" FT /product="small mitochondrial carrier import zinc finger FT protein tim8" FT /fasta_file="fasta/c13G6.tab.seq.00461.out" FT misc_feature 210205..210210 FT /colour=6 FT /note="gtatga, splice donor sequence" FT intron 210205..210261 FT /note="intron confirmed by EST coverage" FT misc_feature 210245..210261 FT /colour=6 FT /note="ctaatccaaaaccttag, splice branch and acceptor" FT CDS complement(join(210753..211112,211161..211250, FT 211308..211425,211677..211846)) FT /colour=7 FT /gene="SPAC13G6.05c" FT /label=SPAC13G6.05c FT /note="SPAC13G6.05c, len:245, SIMILARITY:Homo sapiens, FT O75865, r32611_2, (160 aa), fasta scores: opt: 310, FT E():1.9e-12, (34.4% identity in 157 aa)" FT /product="Possibly required for modification of FT glycosylphosphatidylinositol (GPI) by similar to S. FT cerevisiae las21,gpi13" FT /fasta_file="fasta/c13G6.tab.seq.00462.out" FT misc_feature complement(211113..211130) FT /colour=6 FT /note="ctaatcgtttctttttag, splice branch and acceptor" FT misc_feature complement(211155..211160) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(211251..211270) FT /colour=6 FT /note="ctaacggtttaaaaatttag, splice branch and acceptor" FT misc_feature complement(211302..211307) FT /colour=6 FT /note="gtacaa, splice donor sequence" FT misc_feature complement(211426..211437) FT /colour=6 FT /note="ttgattgaacag, splice branch and acceptor" FT misc_feature complement(211671..211676) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(212652..215705) FT /EC_number="1.4.4.2" FT /colour=7 FT /gene="SPAC13G6.06c" FT /label=SPAC13G6.06c FT /note="SPAC13G6.06c, len:1017, SIMILARITY:Caenorhabditis FT elegans., Q21962, similar to glycine dehydrogenase., (979 FT aa), fasta scores: opt: 3081, E():0, (50.9% identity in FT 978 aa)" FT /product="putative glycine dehydrogenase (decarboxylating)" FT /fasta_file="fasta/c13G6.tab.seq.00463.out" FT CDS complement(216520..217239) FT /colour=2 FT /gene="rps6-1" FT /gene="SPAC13G6.07c" FT /label=rps6-1 FT /note="SPAC13G6.07c, len:239aa" FT /product="40S ribosomal protein S6" FT /fasta_file="fasta/c13G6.tab.seq.00464.out" FT misc_feature complement(216859..217239) FT /colour=9 FT /note="Pfam match to entry PF01092 Ribosomal_S6e, FT Ribosomal protein S6e, score 309.70, E-value 3.5e-89" FT misc_feature complement(217051..217086) FT /colour=8 FT /note="PS00578 Ribosomal protein S6e signature" FT misc_feature complement(217304..217311) FT /colour=4 FT /note="Homol D box" FT CDS 218053..219660 FT /colour=7 FT /gene="SPAC13G6.08" FT /label=SPAC13G6.08 FT /note="SPAC13G6.08c, len:535, FT SIMILARITY:Schizosaccharomyces pombe, O94411, putative wd- FT domain protein., (509 aa), fasta scores: opt: 1109, E():0, FT (39.6% identity in 487 aa)" FT /product="putative activator of anaphase promoting complex FT (APC); required for microtubule function at mitosis and FT for exit from anaphase; WD repeat protein" FT /fasta_file="fasta/c13G6.tab.seq.00465.out" FT misc_feature 218710..218826 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 0.00, E-value 55" FT misc_feature 218833..218955 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 2.80, E-value 24" FT misc_feature 218986..219102 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 26.20, E-value 0.00079" FT misc_feature 219115..219237 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 0.10, E-value 54" FT CDS join(219998..220260,220406..220967) FT /colour=7 FT /gene="SPAC13G6.09" FT /label=SPAC13G6.09 FT /note="SPAC13G6.09, len:274, SIMILARITY:Rattus norvegicus, FT RP8_RAT, zinc finger protein rp-8, (287 aa), fasta scores: FT opt: 326, E():6.5e-14, (30.9% identity in 194 aa)" FT /product="possibly associated with programmed cell death/ FT apoptosis by similar to C. elegans R07E5.10 and human and FT rat RP-8 proteins; Pfam-B_4773; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c13G6.tab.seq.00466.out" FT misc_feature 220261..220266 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 220386..220405 FT /colour=6 FT /note="ctaactttacatttacttag, splice branch and acceptor" FT CDS complement(221972..223564) FT /colour=8 FT /gene="SPAC13G6.10c" FT /label=SPAC13G6.10c FT /note="SPAC13G6.10c, len:530, SIMILARITY:Leishmania major., FT CAB46679, proteophosphoglycan , (873 aa), fasta scores: FT opt: 418, E():2.4e-14, (40.1% identity in 247 aa)" FT /product="hypothetical serine-rich protein; sequence FT orphan; predicted N-terminal signal sequence" FT /fasta_file="fasta/c13G6.tab.seq.00467.out" FT CDS complement(join(223795..224934,225184..225258)) FT /EC_number="2.7.1.36" FT /colour=7 FT /gene="SPAC13G6.11c" FT /label=SPAC13G6.11c FT /note="SPAC13G6.11c, len:404, SIMILARITY:Homo sapiens, FT KIME_HUMAN, mevalonate kinase, (396 aa), fasta scores: FT opt: 722, E():0, (36.7% identity in 398 aa)" FT /product="putative mevalonate kinase" FT /fasta_file="fasta/c13G6.tab.seq.00468.out" FT misc_feature complement(224581..224616) FT /colour=8 FT /note="PS00627 GHMP kinases putative ATP-binding domain" FT misc_feature complement(224722..224934) FT /colour=9 FT /note="Pfam match to entry PF00288 GHMP_kinases, GHMP FT kinases putative ATP-binding proteins" FT misc_feature complement(224935..224946) FT /colour=6 FT /note="ctaactttctag, splice branch and acceptor" FT intron complement(224935..225183) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(225178..225183) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(225851..225863) FT /colour=6 FT /note="ctaactataatag, splice branch and acceptor" FT misc_feature complement(225891..225896) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(227318..227806) FT /colour=9 FT /note="Pfam match to entry PF01644 Chitin_synth, Chitin FT synthase, score 479.90, E-value 2e-140" FT misc_feature 227793..234318 FT /note="overlap with cosmid SPAC24B11 EM:Z67757, S. pombe FT chromosome 1" FT misc_feature 230079..230198 FT /colour=9 FT /note="Pfam match to entry PF00293 mutT, Bacterial mutT FT protein, score 25.10, E-value 1.2e-05" FT misc_feature 227793..234318 FT /note="nominal overlap with cosmid SPAC13G6, EM: Z54308 FT S.pombe chromosome 1" FT misc_feature 230079..230198 FT /colour=9 FT /note="Pfam match to entry PF00293 mutT, Bacterial mutT FT protein," FT CDS 234889..235569 FT /colour=7 FT /gene="SPAC24B11.05" FT /label=SPAC24B11.05 FT /note="SPAC24B11.05, len:226, SIMILARITY:Saccharomyces FT cerevisiae, YGX4_YEAST, hypothetical 32.0 kD protein in FT gog5-nif3 intergenic region., (280 aa), fasta scores: opt: FT 632, E():0, (44.2% identity in 224 aa)" FT /product="putative haloacid dehalogenase-like hydrolase" FT /fasta_file="fasta/c24B11.tab.seq.00788.out" FT misc_feature 234901..235473 FT /colour=9 FT /note="Pfam match to entry PF00702 Hydrolase, haloacid FT dehalogenase-like hydrolase," FT CDS complement(236540..237589) FT /colour=2 FT /gene="sty1" FT /gene="spc1" FT /gene="phh1" FT /gene="SPAC24B11.06c" FT /label=sty1 FT /note="SPAC24B11.06c, len:349" FT /product="serine/threonine protein kinase; stess activated FT MAP kinase (MAPK); acts downstream of 2 component response FT regulator; similar to S. cerevisiae HOG1" FT /fasta_file="fasta/c24B11.tab.seq.00789.out" FT misc_feature complement(236693..237532) FT /colour=9 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT protein kinase domain," FT misc_feature complement(237143..237181) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(237488..237514) FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT CDS complement(239022..240707) FT /colour=8 FT /gene="SPAC24B11.07c" FT /label=SPAC24B11.07c FT /note="SPAC24B11.07c, len:561, similar to S. pombe FT SPCC1902.02" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c24B11.tab.seq.00790.out" FT CDS complement(241710..242882) FT /colour=7 FT /gene="SPAC24B11.08c" FT /label=SPAC24B11.08c FT /note="SPAC24B11.08c, len:390, SIMILARITY:Homo sapiens, FT AAD27763, hypothetical 43.2 kDa protein, (383 aa), fasta FT scores: opt: 763, E():0, (36.8% identity in 389 aa)" FT /product="involved in vesicular transport between the FT endoplasmic reticulum and Golgi apparatus by similar to S. FT cerevisiae erv46" FT /fasta_file="fasta/c24B11.tab.seq.00791.out" FT mRNA 245023..245224 FT /colour=3 FT /note="mRNA from AU008536, not associated with an ORF" FT CDS 246159..246515 FT /colour=10 FT /gene="SPAC24B11.09" FT /label=SPAC24B11.09 FT /note="SPAC24B11.09, len:118, SIMILARITY:Caenorhabditis FT elegans, YXX3_CAEEL, hypothetical 16.3 kD protein f53f10.3 FT in chromosome i, (145 aa), fasta scores: opt: 354, FT E():4.9e-20, (49.5% identity in 103 aa)" FT /product="conserved protein" FT /fasta_file="fasta/c24B11.tab.seq.00792.out" FT CDS complement(248333..251131) FT /colour=7 FT /gene="SPAC24B11.10c" FT /label=SPAC24B11.10c FT /note="Possibility of splicing at 3' end but extra exon FT (20311..20497) doesn't improve homology" FT /note="SPAC24B11.10c, len:93, SIMILARITY:Saccharomyces FT cerevisiae, SKT5_YEAST, skt5 protein., (696 aa), fasta FT scores: opt: 560, E():1.6e-23, (26.8% identity in 559 aa)" FT /product="similar to S. cerevisiae protoplast regeneration FT and killer toxin resistance protein" FT /fasta_file="fasta/c24B11.tab.seq.00793.out" FT CDS complement(251705..253528) FT /colour=2 FT /gene="sid2" FT /gene="SPAC24B11.11c" FT /label=sid2 FT /note="SPAC24B11.11c, len:606, SIMILARITY:Saccharomyces FT cerevisiae, DBFB_YEAST, protein kinase dbf20, (564 aa), FT fasta scores: opt: 1652, E():0, (45.7% identity in 575 aa)" FT /product="serine/threonine protein kinase; protein kinase FT C terminal domain; involved in cytokinesis; similar to S. FT cerevisiae DBF2 and DBF20" FT /fasta_file="fasta/c24B11.tab.seq.00794.out" FT misc_feature complement(251900..252004) FT /colour=9 FT /note="Pfam match to entry PF00433 pkinase_C, protein FT kinase C terminal domain," FT misc_feature complement(252005..252907) FT /colour=9 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT protein kinase domain," FT misc_feature complement(252512..252550) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(252863..252889) FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT CDS complement(join(254072..257908,257988..258359)) FT /EC_number="3.6.3.1" FT /colour=7 FT /gene="SPAC24B11.12c" FT /label=SPAC24B11.12c FT /note="SPAC24B11.12c, len:1402, FT SIMILARITY:Schizosaccharomyces pombe, O36028, putative FT calcium-transporting atpase, (1367 aa), fasta scores: opt: FT 3138, E():0, (47.1% identity in 1247 aa)" FT /product="P-type calcium ATPase" FT /fasta_file="fasta/c24B11.tab.seq.00795.out" FT misc_feature complement(255690..256163) FT /colour=9 FT /note="Pfam match to entry PF00122 E1-E2_ATPase, E1-E2 FT ATPases," FT misc_feature complement(256556..256576) FT /colour=8 FT /note="PS00154 E1-E2 ATPases phosphorylation site" FT misc_feature complement(256620..256682) FT /colour=9 FT /note="Pfam match to entry PF00122 E1-E2_ATPase, E1-E2 FT ATPases," FT misc_feature complement(257909..257926) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaacgttttatg tag" FT misc_feature complement(257982..257987) FT /colour=2 FT /note="splice donor sequence, gtatgc" FT misc_feature 259951..261706 FT /note="nominal overlap with cosmid SPAC806, EM:AL117212 S. FT pombe chromosome 1" FT misc_feature 261349..261705 FT /colour=9 FT /note="Pfam match to entry PF01379 Porphobil_deam, FT Porphobilinogen deaminase," FT misc_feature 259951..261706 FT /note="nominal overlap with cosmid SPAC24B11, EM:Z67757 S. FT pombe chromosome 1" FT misc_feature 261349..262269 FT /note="Match to PF01379 Porphobil_deam, Porphobilinogen FT deaminase Score 606.68" FT CDS complement(join(262907..264729,264779..264782)) FT /colour=7 FT /gene="SPAC806.02c" FT /label=SPAC806.02c FT /note="SPAC806.02c, len:608, SIMILARITY:Saccharomyces FT cerevisiae, YIA3_YEAST, hypothetical 31.9 kD protein in FT bet1-pan1 intergenic region., (293 aa), fasta scores: opt: FT 926, E():0, (55.9% identity in 286 aa)" FT /product="WD repeat protein" FT /fasta_file="fasta/c806.tab.seq.00720.out" FT misc_feature complement(262916..262990) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 20.31" FT misc_feature complement(263252..263347) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 40.01" FT misc_feature complement(263384..263494) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 30.42" FT misc_feature complement(263519..263629) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 47.84" FT misc_feature complement(263780..263893) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 36.97" FT misc_feature complement(264730..264744) FT /colour=6 FT /note="ttaactttataatag, splice branch and acceptor" FT misc_feature complement(264773..264778) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT CDS complement(265329..265691) FT /colour=2 FT /gene="rps26-1" FT /gene="SPAC806.03c" FT /label=rps26 FT /note="SPAC806.03c, len:120, SIMILARITY:Neurospora crassa., FT RS26_NEUCR, 40S ribosomal protein S26e, (119 aa), fasta FT scores: opt: 614, E():0, (71.4% identity in 119 aa)" FT /product="40S ribosomal protein S26" FT /fasta_file="fasta/c806.tab.seq.00721.out" FT misc_feature complement(265353..265691) FT /note="Match to PF01283 Ribosomal_S26e, Ribosomal protein FT S26e Score 246.59" FT misc_RNA complement(266725..267524) FT /note="misc RNA associated with spc02611 spc02031, FT possiible celllular RNA as no obvious open reading frame FT or spliced gene in this region" FT CDS complement(join(271102..271213,271265..271369, FT 271411..272491,272593..272617)) FT /colour=10 FT /gene="SPAC806.04c" FT /label=SPAC806.04c FT /note="SPAC806.04c, len:429, FT SIMILARITY:Schizosaccharomyces pombe, O94725, hypothetical FT 50.1 kD protein., (442 aa), fasta scores: opt: 1822, E():0, FT (60.5% identity in 441 aa)" FT /product="conserved protein" FT /fasta_file="fasta/c806.tab.seq.00722.out" FT misc_feature complement(271214..271227) FT /colour=6 FT /note="ctaacaggaaatag, splice branch and acceptor" FT misc_feature complement(271259..271264) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(271370..271380) FT /colour=6 FT /note="ctaaactacag, splice branch and acceptor" FT misc_feature complement(271405..271410) FT /colour=6 FT /note="gtgctt, splice donor sequence" FT misc_feature complement(272492..272511) FT /colour=6 FT /note="ttaatgctttgttaacctag, splice branch and acceptor" FT misc_feature complement(272587..272592) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 273341..273344 FT /note="True l.h end of c1639 S. pombe chromosome 1" FT CDS 274407..274784 FT /colour=9 FT /gene="SPAC806.05" FT /label=SPAC806.05 FT /note="SPAC806.05, len:125" FT /product="very hypothetical protein" FT /fasta_file="fasta/c806.tab.seq.00723.out" FT CDS complement(274980..276077) FT /colour=7 FT /gene="SPAC806.06c" FT /label=SPAC806.06c FT /note="SPAC806.06c, len:365, SIMILARITY:Saccharomyces FT cerevisiae, Q06178, chromosome xii cosmid 8543., (401 aa), FT fasta scores: opt: 1344, E():0, (72.1% identity in 272 aa)" FT /product="putative nicotinamide mononucleotide (NMN) FT adenylyltransferase; similar to S. cerevisiae YLR328W" FT /fasta_file="fasta/c806.tab.seq.00724.out" FT CDS 277604..278059 FT /EC_number="2.7.4.6" FT /colour=2 FT /gene="ndk1" FT /gene="SPAC806.07" FT /label=ndk1 FT /note="SPAC806.07, len:151" FT /product="nucleoside diphosphate kinase" FT /fasta_file="fasta/c806.tab.seq.00725.out" FT misc_feature 277613..278056 FT /note="Match to PF00334 NDK, Nucleoside diphosphate FT kinases Score 335.35" FT CDS complement(278356..280212) FT /colour=8 FT /gene="SPAC806.08c" FT /label=SPAC806.08c FT /note="SPAC806.08c, len:618, SIMILARITY:Neisseria FT meningitidis., Q51281, alpha-2,8-polysialyltransferase, FT (495 aa), fasta scores: opt: 125, E():0.91, (20.5% FT identity in 298 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c806.tab.seq.00021.out" FT misc_feature 280539..282820 FT /note="nominal overlap with cosmid SPAC1639, EM:AL117213 FT S. pombe chromosome 1" FT misc_feature complement(join(281585..282013,282068..282428)) FT /note="Match to PF01151 GNS1_SUR4, GNS1/SUR4 family Score FT 315.69" FT misc_feature complement(282014..282029) FT /colour=6 FT /note="ctaacatacgttttag, splice branch and acceptor" FT misc_feature complement(282062..282067) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(282429..282442) FT /colour=6 FT /note="ctaacaatttttag, splice branch and acceptor" FT misc_feature complement(282615..282620) FT /colour=6 FT /note="gtatta, splice donor sequence" FT misc_feature 280539..282820 FT /note="nominal overlap with cosmid SPAC806, EM:AL117212 S. FT pombe chromosome 1" FT misc_feature complement(join(281585..282000,282055..282448)) FT /note="Match to PF01151 GNS1_SUR4, GNS1/SUR4 family Score FT 315.69" FT misc_feature complement(282014..282029) FT /colour=6 FT /note="ctaacatacgttttag, splice branch and acceptor" FT misc_feature complement(282062..282067) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(282429..282442) FT /colour=6 FT /note="ctaacaatttttag, splice branch and acceptor" FT misc_feature complement(282615..282620) FT /colour=6 FT /note="gtatta, splice donor sequence" FT misc_feature complement(284795..286139) FT /note="nominal overlap with cosmid SPAC1F5, EM:Z68136 S. FT pombe chromosome 1" FT misc_feature complement(285811..285831) FT /colour=6 FT /note="ctaacggtttatttactttag, splice branch and acceptor" FT misc_feature complement(286015..286020) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 284795..286139 FT /note="nominal overlap with cosmid SPAC1639, EM:AL117213 FT S. pombe chromosome 1" FT misc_feature complement(285811..285831) FT /colour=6 FT /note="ctaacggtttatttactttag, splice branch and acceptor" FT misc_feature complement(286015..286020) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(286047..286067) FT /colour=6 FT /note="ttaacgattttaaaaaaacag, splice branch and acceptor" FT misc_feature complement(286097..286102) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature complement(286122..286136) FT /colour=6 FT /note="ctaataatggtttag, splice branch and acceptor" FT misc_feature complement(286212..286217) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(286289..286302) FT /colour=6 FT /note="ttaactcataaaag, splice branch and acceptor" FT misc_feature complement(286354..286359) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(286427..286438) FT /colour=6 FT /note="ttaacggaatag, splice branch and acceptor" FT misc_feature complement(286467..286472) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(286686..286701) FT /colour=6 FT /note="ctaaatagctttttag, splice branch and acceptor" FT misc_feature complement(286725..286730) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature complement(286747..286761) FT /colour=6 FT /note="ctaacaatggactag, splice branch and acceptor" FT misc_feature complement(286786..286791) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(286812..286822) FT /colour=6 FT /note="ctgatcattag, splice branch and acceptor" FT misc_feature complement(286849..286854) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature complement(286858..286873) FT /colour=6 FT /note="ctaacgtttaatttag, splice branch and acceptor" FT misc_feature complement(286899..286904) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(287861..287871) FT /colour=6 FT /note="ttgacctttag, splice branch and acceptor" FT misc_feature complement(287890..287895) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(288797..288811) FT /colour=6 FT /note="ttaactattttttag, splice branch and acceptor" FT misc_feature complement(288831..288836) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS join(289395..289458,289520..300423) FT /colour=7 FT /gene="SPAC1F5.11c" FT /label=SPAC1F5.11c FT /note="SPAC1F5.11c, len:3655, SIMILARITY:Saccharomyces FT cerevisiae, YHP9_YEAST, hypothetical 433.2 kD strong FT similar to human TRRAP protein, (3744 aa), fasta scores: FT opt: 2959, E():0, (33.3% identity in 3828 aa)" FT /product="putative phosphatidylinositol kinase; TPR domain FT protein; similar to S. cerevisiae TRA1" FT /fasta_file="fasta/c1F5.tab.seq.02048.out" FT misc_feature 289459..289464 FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature 289505..289519 FT /colour=6 FT /note="ctaactttttttaag, splice branch and acceptor" FT misc_feature 293356..293379 FT /note="PS00017 ATP/GTP-binding site motif A" FT misc_feature 295891..295947 FT /note="PS00095 C-5 cytosine-specific DNA methylasesC- FT termin al signature" FT CDS complement(join(300696..301792,301846..301866, FT 301933..301999)) FT /colour=2 FT /gene="tif412" FT /gene="SPAC1F5.10" FT /label=tif412 FT /note="SPAC1F5.10, len:394" FT /product="eukaryotic initiation factor 4a" FT /fasta_file="fasta/c1F5.tab.seq.02049.out" FT misc_feature complement(300816..301055) FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 131.36" FT misc_feature complement(301170..301781) FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 185.78" FT misc_feature complement(301353..301379) FT /note="PS00039 DEAD-box subfamily ATP-dependent FT helicasessi gnature" FT misc_feature complement(301665..301688) FT /note="PS00017 ATP/GTP-binding site motif A" FT misc_feature complement(301793..301806) FT /colour=6 FT /note="ctaacaacatgcag, splice branch and acceptor" FT misc_feature complement(301840..301845) FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature complement(301867..301883) FT /colour=6 FT /note="ctaacattgttttgcag, splice branch and acceptor" FT misc_feature complement(301927..301932) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 302828..304597 FT /colour=2 FT /gene="shk2" FT /gene="pak2" FT /gene="SPAC1F5.09c" FT /label=shk2 FT /note="SPAC1F5.09c, len:589" FT /product="serine/threonine protein kinase; pleckstrain FT homology domain; P21 activated MAP kinase shk2" FT /fasta_file="fasta/c1F5.tab.seq.02050.out" FT misc_feature 302894..303193 FT /note="Match to PF00169 PH, PH domain Score 29.58" FT misc_feature 303212..303388 FT /note="Match to PF00786 PBD, P21-Rho-binding domain Score FT 114.90" FT misc_feature 303752..304525 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 301.44" FT misc_feature 304115..304153 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS 304765..306225 FT /colour=2 FT /gene="yam8" FT /gene="ehs1" FT /gene="SPAC1F5.08c" FT /note="SPAC1F5.08c, len:486, SIMILARITY:Saccharomyces FT cerevisiae, MID1_YEAST, mid1 protein., (548 aa), fasta FT scores: opt: 514, E():1.2e-24, (30.7% identity in 433 aa)" FT /product="calcium channel; similar to S. cerevisiae MID1" FT /fasta_file="fasta/c1F5.tab.seq.02051.out" FT CDS 306569..308041 FT /EC_number="1.3.3.4" FT /colour=7 FT /gene="SPAC1F5.07c" FT /label=SPAC1F5.07c FT /note="SPAC1F5.07c, len:490, SIMILARITY:Homo sapiens, FT PPOX_HUMAN, protoporphyrinogen oxidase, (477 aa), fasta FT scores: opt: 568, E():4.1e-29, (31.1% identity in 492 aa)" FT /product="putative protoporphyrinogen oxidase" FT /fasta_file="fasta/c1F5.tab.seq.02052.out" FT CDS complement(308275..310821) FT /colour=7 FT /gene="SPAC1F5.06" FT /label=SPAC1F5.06 FT /note="SPAC1F5.06, len:848, SIMILARITY:Homo sapiens, FT AAC50947, 150 kDa oxygen-regulated protein orp150., (999 FT aa), fasta scores: opt: 961, E():0, (36.6% identity in 454 FT aa)" FT /product="heast shock protein 70 family" FT /fasta_file="fasta/c1F5.tab.seq.02053.out" FT misc_feature complement(309676..309720) FT /note="PS01036 Heat shock hsp70 proteins family signature3" FT CDS 311625..312080 FT /colour=8 FT /gene="SPAC1F5.05c" FT /label=SPAC1F5.05c FT /note="SPAC1F5.05c, len:151" FT /product="hypothetical protein; sequence orphan; has EST" FT /fasta_file="fasta/c1F5.tab.seq.02054.out" FT CDS 313152..318677 FT /colour=2 FT /gene="cdc12" FT /gene="SPAC1F5.04c" FT /label=cdc12 FT /note="SPAC1F5.04c, len:1841" FT /product="formin; required for actin ring assembly; FT predicted regulator of cell polarity" FT /fasta_file="fasta/c1F5.tab.seq.02055.out" FT CDS join(319628..319661,319863..320977) FT /colour=10 FT /gene="SPAC1F5.03c" FT /label=SPAC1F5.03c FT /note="SPAC1F5.03c, len:382, SIMILARITY:Saccharomyces FT cerevisiae, YHG9_YEAST, hypothetical 57.0 kD protein in FT sod2-rpl27a intergenic region., (518 aa), fasta scores: FT opt: 303, E():1.8e-12, (30.6% identity in 496 aa);" FT /product="putative oxidoreductase; similar to D-amino-acid FT oxidases; similar to S. cerevisiae YHR009C" FT /fasta_file="fasta/c1F5.tab.seq.02056.out" FT misc_feature 319662..319667 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 319845..319862 FT /colour=6 FT /note="ctaacaaatatttttcag, splice branch and acceptor" FT CDS complement(321936..323414) FT /EC_number="5.3.4.1" FT /colour=7 FT /gene="SPAC1F5.02" FT /label=SPAC1F5.02 FT /note="SPAC1F5.02, len:492, SIMILARITY:Trichoderma reesei, FT O74568, protein disulphide isomerase ., (502 aa), fasta FT scores: opt: 1330, E():0, (41.5% identity in 499 aa)" FT /product="putative protein disulphide isomerase" FT /fasta_file="fasta/c1F5.tab.seq.02057.out" FT misc_feature complement(322251..322271) FT /note="PS00194 Thioredoxin family active site" FT misc_feature complement(323034..323354) FT /note="Match to PF00085 thiored, Thioredoxin Score 151.08" FT misc_feature complement(323253..323273) FT /note="PS00194 Thioredoxin family active site" FT misc_feature complement(324156..325036) FT /note="overlap with cosmid SPAC18B11, EM:Z50728 S.pombe FT chromosome I" FT misc_feature complement(324156..325036) FT /note="overlap with cosmid SPAC1F5, EM:Z68136 S.pombe FT chromosome 1" FT CDS complement(join(329304..330939,331112..331196, FT 331264..331387)) FT /colour=2 FT /gene="tup11" FT /gene="SPAC18B11.10" FT /label=tup11 FT /note="SPAC18B11.10, len:614, SIMILARITY:Neurospora FT crassa., RCO1_NEUCR, transcriptional repressor rco-1., FT (604 aa), fasta scores: opt: 1424, E():0, (42.5% identity FT in 626 aa)" FT /product="Transcriptional repressor functioning FT redundantly with Tup12p; homolog of S. cerevisiae Tup1p FT glucose repression regulatory protein; WD repeat protein; FT subcellular localization of GFP fusion- Nucleus" FT /fasta_file="fasta/c18B11.tab.seq.02022.out" FT misc_feature complement(329325..329426) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 42.08" FT misc_feature complement(329451..329567) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 33.49" FT misc_feature complement(329610..329654) FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature complement(329616..329729) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 53.72" FT misc_feature complement(329736..329822) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 29.02" FT misc_feature complement(329856..329900) FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature complement(329859..329972) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 61.40" FT misc_feature complement(329982..330026) FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature complement(329985..330065) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 30.97" FT misc_feature complement(330940..330952) FT /colour=6 FT /note="ctaacatttatag, splice branch and acceptor" FT misc_feature complement(331106..331111) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(331197..331218) FT /colour=6 FT /note="ctaacattctgttctattgcag, splice branch and acceptor" FT misc_feature complement(331258..331263) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 332396..332505 FT /note="similar to a region inteRNAl to predicted protein FT sequence SPBC16H5.13 70% at the DNA level" FT CDS join(332837..332907,333010..333316,333392..333469, FT 333528..333695) FT /colour=7 FT /gene="SPAC18B11.09c" FT /label=SPAC18B11.09c FT /note="SPAC18B11.09c, len:207, SIMILARITY:Saccharomyces FT cerevisiae, YJV8_YEAST, putative acetyltransferase, (196 FT aa), fasta scores: opt: 459, E():0, (40.7% identity in 189 FT aa ov erlap)" FT /product="putative acetyltransferase; similar to S. FT cerevisiae YJL218W" FT /fasta_file="fasta/c18B11.tab.seq.02023.out" FT misc_feature 332908..332913 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 332992..333009 FT /colour=6 FT /note="ctaattactaaataacag, splice branch and acceptor" FT misc_feature 333185..333223 FT /colour=9 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats)" FT misc_feature 333293..333397 FT /colour=9 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats)" FT misc_feature 333317..333322 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 333374..333391 FT /colour=6 FT /note="ctaatggtgtctttccag, splice branch and acceptor" FT misc_feature 333470..333475 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 333505..333527 FT /colour=6 FT /note="ctaacaaacaaaattttatcaag, splice branch and acceptor" FT misc_feature 333528..333632 FT /note="Match to PF00132 hexapep, Bacterial transferase FT hexapeptide (four repeats) Score 72.86" FT misc_feature 333546..333632 FT /colour=8 FT /note="PS00101 Bacterial hexapeptide-repeat containing- FT tran sferases signature" FT CDS join(334139..334211,334350..334407,334447..334536, FT 334595..334631,334676..334705) FT /colour=10 FT /gene="SPAC18B11.08c" FT /label=SPAC18B11.08c FT /note="SPAC18B11.08c, len:95, SIMILARITY:Saccharomyces FT cerevisiae, Q12160, hypothetical 15.4 kD protein ypr056c., FT (140 aa), fasta scores: opt: 103, E():0.18, (28.0% FT identity in 118 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YPR063C" FT /fasta_file="fasta/c18B11.tab.seq.00034.out" FT misc_feature 334212..334217 FT /colour=6 FT /note="gtaaag, splice donor sequence" FT misc_feature 334335..334349 FT /colour=6 FT /note="ctaaccctattatag, splice branch and acceptor" FT misc_feature 334408..334413 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 334436..334446 FT /colour=6 FT /note="ttaacgagaag, splice branch and acceptor" FT misc_feature 334537..334542 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 334580..334594 FT /colour=6 FT /note="ttaacatttgatcag, splice branch and acceptor" FT misc_feature 334632..334637 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 334663..334675 FT /colour=6 FT /note="ttaacttgtgcag, splice branch and acceptor" FT CDS join(335399..335440,335488..335552,335766..335886, FT 335992..336095,336144..336267) FT /EC_number="6.3.2.19" FT /colour=2 FT /gene="rhp6" FT /gene="ubc2" FT /gene="SPAC18B11.07c" FT /label=rhp6 FT /note="SPAC18B11.07c, len:151" FT /product="ubiquitin-conjugating enzyme e2-17 kD; similar FT to S. cerevisiae RAD6" FT /fasta_file="fasta/c18B11.tab.seq.02025.out" FT misc_feature 335441..335446 FT /colour=6 FT /note="gtacgg, splice donor sequence" FT misc_feature 335473..335487 FT /colour=6 FT /note="ttaaccaattcttag, splice branch and acceptor" FT misc_feature join(335488..335552,335766..335886,335992..336095, FT 336144..336252) FT /note="Match to PF00179 UQ_con, Ubiquitin-conjugating FT enzyme Score 213.59" FT misc_feature 335553..335558 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 335750..335765 FT /colour=6 FT /note="ctaaccatttgagcag, splice branch and acceptor" FT misc_feature 335887..335892 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 335974..335991 FT /colour=6 FT /note="cttacttattggctttag, splice branch and acceptor" FT misc_feature 335992..336036 FT /colour=8 FT /note="PS00183 Ubiquitin-conjugating enzymes active site" FT misc_feature 336096..336101 FT /colour=6 FT /note="gtttgc, splice donor sequence" FT misc_feature 336133..336143 FT /colour=6 FT /note="ctaacttttag, splice branch and acceptor" FT CDS complement(336640..337623) FT /colour=7 FT /gene="SPAC18B11.06" FT /label=SPAC18B11.06 FT /note="SPAC18B11.06, len:327, SIMILARITY:Saccharomyces FT cerevisiae, YEV7_YEAST, hypothetical 40.8 kD protein in FT rsp5-pak1 intergenic region., (357 aa), fasta scores: opt: FT 204, E():2.6e-05, (27.6% identity in 308 aa)" FT /product="putative U3 snoRNP component; required for pre- FT 18S rRNA processing; similar to S. cerevisiae LCP5" FT /fasta_file="fasta/c18B11.tab.seq.02026.out" FT CDS complement(338057..339337) FT /colour=10 FT /gene="SPAC18B11.05" FT /label=SPAC18B11.05 FT /note="SPAC18B11.05, len:426, SIMILARITY:Saccharomyces FT cerevisiae, YBL4_YEAST, hypothetical 50.8 kD protein in FT coq1-flr1 intergenic region ., (433 aa), fasta scores: FT opt: 320, E():1.9e-13, (29.4% identity in 446 aa)" FT /product="protein similar to YBR004C expresssed between 3 FT and 6 hours after transfer to sporulation medium" FT /fasta_file="fasta/c18B11.tab.seq.02027.out" FT CDS complement(join(340335..340466,340513..340856, FT 340975..341007,341047..341110)) FT /colour=7 FT /gene="SPAC18B11.04" FT /label=SPAC18B11.04 FT /note="SPAC18B11.04, len:190, SIMILARITY:Mus musculus, FT AAD01642, neuronal calcium sensor-1., (190 aa), fasta FT scores: opt: 910, E():0, (69.5% identity in 190 aa)" FT /product="related to neuronal calcium sensor 1 proteins" FT /fasta_file="fasta/c18B11.tab.seq.02028.out" FT misc_feature complement(340383..340463) FT /note="Match to PF00036 efhand, EF hand Score 32.76" FT misc_feature complement(340401..340439) FT /colour=8 FT /note="PS00018 EF-hand calcium-binding domain" FT misc_feature complement(340467..340481) FT /colour=6 FT /note="ctaataattttttag, splice branch and acceptor" FT misc_feature complement(340507..340512) FT /colour=6 FT /note="gtttga, splice donor sequence" FT misc_feature complement(340570..340647) FT /note="Match to PF00036 efhand, EF hand Score 26.35" FT misc_feature complement(340591..340629) FT /colour=8 FT /note="PS00018 EF-hand calcium-binding domain" FT misc_feature complement(340684..340752) FT /note="Match to PF00036 efhand, EF hand Score 33.86" FT misc_feature complement(340699..340737) FT /colour=8 FT /note="PS00018 EF-hand calcium-binding domain" FT misc_feature complement(340857..340871) FT /colour=6 FT /note="ctaacaagtatgcag, splice branch and acceptor" FT misc_feature complement(340969..340974) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(341008..341021) FT /colour=6 FT /note="ctaacaaatccaag, splice branch and acceptor" FT misc_feature complement(341041..341046) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT CDS 341940..343262 FT /colour=10 FT /gene="SPAC18B11.03c" FT /label=SPAC18B11.03c FT /note="SPAC18B11.03c, len:440, SIMILARITY:Saccharomyces FT cerevisiae, YG4K_YEAST, hypothetical 54.5 kD protein in FT zpr1-rta1 intergenic region., (468 aa), fasta scores: opt: FT 160, E():0.0018, (22.8% identity in 452 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGR212W" FT /fasta_file="fasta/c18B11.tab.seq.02029.out" FT CDS 343706..344890 FT /colour=7 FT /gene="SPAC18B11.02c" FT /label=SPAC18B11.02c FT /note="SPAC18B11.02c, len:394, SIMILARITY:Saccharomyces FT cerevisiae, YD36_YEAST, hypothetical 53.4 kD protein in FT prp9-nat1 intergenic region., (462 aa), fasta scores: opt: FT 1120, E():0, (47.8% identity in 393 aa)" FT /product="putative DRAP deaminase; riboflavin biosynthesis FT pathway; similar to S. cerevisiae RIB2" FT /fasta_file="fasta/c18B11.tab.seq.02030.out" FT misc_feature 344027..344497 FT /note="Match to PF00849 YABO, Hypothetical yabO/yceC/sfhB FT family Score 232.59" FT misc_feature 345383..345691 FT /note="Match to PF00752 XPG_N, XPG N-terminal domain Score FT 183.41" FT misc_feature 346238..346519 FT /note="Match to PF00867 XPG_I, XPG I-region Score 148.50" FT misc_feature complement(346643..347002) FT /note="nominal overlap with cosmid SPAC12G12, EM:Z66568 S. FT pombe chromosome 1" FT CDS complement(join(346986..347138,347190..347848, FT 347897..348617)) FT /colour=10 FT /gene="SPAC12G12.15" FT /label=SPAC12G12.15 FT /note="SPAC12G12.15, len:510, SIMILARITY:Saccharomyces FT cerevisiae, YFL8_YEAST, hypothetical 75.9 kD protein in FT sap155-ymr31 intergenic region., (662 aa), fasta scores: FT opt: 808, E():0, (32.7% identity in 587 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YFR048W" FT /fasta_file="fasta/c12G12.tab.seq.00551.out" FT misc_feature complement(346643..347002) FT /note="nominal overlap with cosmid SPAC18B11, EM:Z50728 S. FT pombe chromosome 1" FT misc_feature complement(347139..347158) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacataagcagct tgaag" FT misc_feature complement(347184..347189) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(347849..347862) FT /colour=2 FT /note="splice branch and accxeptor sequence, FT tattaacgccattt ag" FT misc_feature complement(347891..347896) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT CDS 349650..351179 FT /colour=7 FT /gene="SPAC12G12.14c" FT /label=SPAC12G12.14c FT /note="SPAC12G12.14c, len:509, SIMILARITY:Saccharomyces FT cerevisiae, YN57_YEAST, hypothetical 53.1 kD trp-asp FT repeats containing protein in hxt14-pha2intergenic region., FT (465 aa), fasta scores: opt: 967, E():0, (37.9% identity FT in 472 aa)" FT /product="putative polyadenylation factor I subunit; mRNA FT 3'-end processing; WD repeat protein; similar to S. FT cerevisiae PFS2" FT /fasta_file="fasta/c12G12.tab.seq.00552.out" FT misc_feature 350109..350225 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 350235..350351 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 350361..350483 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 350493..350612 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 350697..350813 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT CDS 351804..353654 FT /colour=2 FT /function="essential gene required for normal chromosome FT segregation" FT /gene="cid14" FT /gene="SPAC12G12.13c" FT /label=cid14 FT /note="SPAC12G12.13c, len:616, SIMILARITY:Saccharomyces FT cerevisiae, TRF4_YEAST, topoisomerase 1-related protein FT trf4., (584 aa), fasta scores: opt: 896, E():0, (31.5% FT identity in 603 aa)" FT /product="putative DNA polymerase sigma; putative FT nucleotidyl transferase; essential; required for normal FT chromosome segregation; similar to S. cerevisiae TRF4 and FT TRF5" FT /fasta_file="fasta/c12G12.tab.seq.00553.out" FT CDS complement(join(353870..354083,354138..354842, FT 354901..354956)) FT /colour=7 FT /gene="SPAC12G12.12" FT /label=SPAC12G12.12 FT /note="SPAC12G12.12, len:324, LOW SIMILARITY:., FT Schizosaccharomyces pombe, O59769, UDP-galactose FT transporter homolog., (329 aa), fasta scores: opt: 185, FT E(): 5.2e-05, (24.0% identity in 329 aa)" FT /product="NST UDP-galactose transporter; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c12G12.tab.seq.00554.out" FT misc_feature complement(354084..354101) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaacgttccaac cttag" FT misc_feature complement(354132..354137) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(354843..354863) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacaaatcatcca aatag" FT misc_feature complement(354895..354900) FT /colour=2 FT /note="splice donor sequence, gtcagt" FT CDS join(356370..356532,356618..357067,357174..357658) FT /colour=10 FT /gene="SPAC12G12.11c" FT /label=SPAC12G12.11c FT /note="SPAC12G12.11c, len:365, SIMILARITY:Saccharomyces FT cerevisiae, Q08930, chromosome xvi reading frame orf FT ypl191c., (360 aa), fasta scores: opt: 287, E():3.7e-11, FT (28.7% identity in 327 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YPL191C; predicted coiled-coil" FT /fasta_file="fasta/c12G12.tab.seq.00555.out" FT misc_feature 356533..356538 FT /colour=2 FT /note="splice donor sequence, gtaatc" FT misc_feature 356602..356617 FT /colour=2 FT /note="splice branch and acceptor sequence, FT cttactttgtattca g" FT misc_feature 357068..357073 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 357158..357173 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacacttcaaata g" FT CDS complement(357898..359160) FT /colour=10 FT /gene="SPAC12G12.10" FT /label=SPAC12G12.10 FT /note="SPAC12G12.10, len:420," FT /product="hypothetical protein; contains 2 WD-repeat FT domains" FT /fasta_file="fasta/c12G12.tab.seq.00556.out" FT CDS complement(359486..362419) FT /colour=8 FT /gene="SPAC12G12.09" FT /label=SPAC12G12.09 FT /note="SPAC12G12.09, len:977," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c12G12.tab.seq.00557.out" FT CDS complement(363371..364012) FT /colour=7 FT /gene="SPAC12G12.08" FT /label=SPAC12G12.08 FT /note="SPAC12G12.08, len:213, SIMILARITY:Saccharomyces FT cerevisiae, RM06_YEAST, 60S ribosomal protein L6, FT